omics.co.in logo omics.co.in

Variables and Data Types

1 min read • Verified October 2026 • Peer-Reviewed Learning Resource
Tested Stacks: GATK 4.6.1 Samtools 1.21 Nextflow 24.10 Seurat v5.1 Python 3.12
Prerequisites: Basic Linux CLI & Sequencing Formats
📚 Chapter 2 of 13 0% Course Completed
🐍 Downloadable Lesson Python Script 3.4 KB

ch02_data_structures.py

Implements dictionaries for genetic codon translation, sets for unique k-mer extraction, and lists of tuples for restriction enzyme motif scanning.

$ python ch02_data_structures.py --seq ATGCGATCGATCGATCGATAGCTAGCTA

Python Variables & Data Types for Genomic Analysis

Understanding native Python data structures—strings, integers, floats, lists, tuples, dictionaries, and sets—is the cornerstone of bioinformatic script development.

# 1. Strings (Genomic sequences, chromosome names)
chromosome = "chr1"
sequence = "AGCTGATCGAT"

# 2. Integers & Floats (Coordinates, p-values, coverage)
start_pos = 1450201
end_pos = 1450550
p_value = 1.45e-8
depth_coverage = 48.6

# 3. Dictionaries (Genetic code mapping)
codon_table = {
    "ATG": "Methionine (Start)",
    "TAA": "Stop",
    "TAG": "Stop",
    "TGA": "Stop"
}

# 4. Sets (Unique gene identifiers)
sample_genes = {"TP53", "EGFR", "BRCA1", "TP53"}
print("Unique genes:", len(sample_genes)) # Output: 3
⚠️

Common Pitfalls & Troubleshooting Checklist

  • Java Heap Exhaustion (GATK / Picard): If processes terminate with java.lang.OutOfMemoryError, set your environment variable explicitly: export _JAVA_OPTIONS="-Xmx16g -Djava.io.tmpdir=/tmp".
  • Index Timestamp Mismatch: If tools complain that a BAM index is missing or out of date, regenerate with samtools index -@ 4 sample.bam.
  • Conda Channel Conflicts: Avoid ABI incompatibilities between bioconda and conda-forge by setting strict priority: conda config --set channel_priority strict.
  • Chromosome Naming Contamination: Always verify whether reference FASTA headers use chr1 or 1; divergent naming causes silent alignment drops.
Was this guide helpful to your research?
Help us maintain 100% accurate, peer-reviewed bioinformatics standards.
📝 Propose Edit on GitHub ↗