Interactive Bio-Calculators & Utility Suite

🚩 SAM Flag Explainer & Bitwise Decoder

The 2nd column in every SAM/BAM file represents a 16-bit integer bitwise flag describing alignment status. Enter any integer flag below or toggle properties to decode its biological meaning.

Quick Presets:

SAM Flag Value (Integer):

Hexadecimal / Binary:

0x0063 • 0b000001100011

Biological & Alignment Meaning

Read is paired, mapped in a proper pair, first in pair (Read 1), and mate is reverse strand.

Bitwise Flags Breakdown (Click to Toggle)

Samtools CLI Quick-Filter Snippet:


# Filter BAM for reads matching this flag:
samtools view -b -f 99 input.bam > flag_99.bam

🔬 NGS Sequencing Coverage & Flow Cell Calculator

Calculate required sequencing throughput in Gigabases (Gb), total paired-end read counts, and optimal flow cell choices across Illumina NovaSeq X, NextSeq 2000, MiSeq, and Element AVITI.

Target Organism / Target Size:

Target Coverage / Depth (x):

Read Length & Mode:

Number of Samples / Multiplexing:

96.0 Gb

Required Data / Sample

320.0 M

Read Pairs / Sample

768.0 Gb

Total Run Yield (Gb)

2.56 Billion

Total Reads to Sequence

Recommended Sequencer Flow Cells & Capacity

Instrument & Flow Cell	Rated Output (Gb)	Rated Reads	Max Samples at This Depth	Capacity Fit

📏 0-Based vs. 1-Based Genomic Coordinate Converter

One of the most persistent sources of off-by-one errors in bioinformatics is the divergence between 0-based half-open formats (BED, Python slices, BAM, UCSC internal) and 1-based fully-closed formats (VCF, GFF3, GTF, R/GenomicRanges, IGV).

Chromosome:

Start Coordinate:

End Coordinate:

Input Convention:

1-Based Fully-Closed System VCF • GFF3 • GTF • R

chr17:41,196,311 - 41,277,500

First base of chromosome is indexed as 1. Both the start and end positions are included in the interval.
Formula: Length = End - Start + 1.

0-Based Half-Open System BED • BAM • Python

chr17:41,196,310 - 41,277,500

First base of chromosome is indexed as 0. Start position is included, but end position is excluded.
Formula: Length = End - Start.

Copy-Paste Code Syntax for This Interval:

# Python 0-based slice:

sequence[41196310:41277500]

# R GenomicRanges:

GRanges("chr17", IRanges(41196311, 41277500))

# BED Line:

chr17	41196310	41277500

# Samtools Region Query:

samtools view in.bam chr17:41196311-41277500

🧪 Oligo Melting Temperature (Tm) & Primer Properties

Nearest-neighbor thermodynamic estimation of PCR primer melting temperatures with monovalent salt and oligo concentration corrections.

Oligo Sequence (5' → 3'):

Primer Concentration (nM):

Monovalent Salt Na⁺ (mM):

Divalent Salt Mg²⁺ (mM):

23 bp

Length

62.8 °C

Melting Temp (Tm)

56.5%

GC Content

7,078 Da

Molecular Weight

Yes (G)

3' GC Clamp

🧬 6-Frame In Silico Translation & ORF Hunter

Translate nucleotide sequences across all 3 forward and 3 reverse reading frames. Automatically detect open reading frames (ORFs) from start codon (ATG) to stop codons (TAA, TAG, TGA).

Input Nucleotide Sequence:

ATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGA

Display Frame:

Bioinformatics Calculators & Sequence Utilities