omics.co.in

7: Modules and Packages

1 min read • Updated Oct 2026 • Peer-Reviewed Learning Resource
🐍 Downloadable Lesson Python Script 2.9 KB

ch07_modules_packages.py

Demonstrates modular library design, IUPAC degenerate nucleotide expansion, and dinucleotide frequency profiling (CpG island detection).

$ python ch07_modules_packages.py --seq ATGCGATCGATC --motif RGYW

Chapter 7: Modules and Packages in Python

As computational biology pipelines expand, keeping all code in a single monolithic script leads to maintenance bottlenecks. Modules and packages allow bioinformaticians to organize algorithms, parsers, and utilities into reusable libraries across projects.

1. Modules Architecture

A module is simply a Python file (e.g. seq_tools.py) containing functions, classes, and variables. Create a file named seq_tools.py with common sequence utilities:

# seq_tools.py - Reusable Genomic Utilities
IUPAC_COMPLEMENT = str.maketrans("ACGTUacgtu", "TGCAAACCAA")

def calculate_gc(sequence):
    """Calculates GC percentage of any nucleotide sequence."""
    seq = sequence.upper()
    g = seq.count("G")
    c = seq.count("C")
    return (g + c) / len(seq) * 100 if len(seq) > 0 else 0.0

def find_orfs(sequence, min_protein_len=50):
    """Identifies candidate Open Reading Frames starting with ATG."""
    orfs = []
    seq = sequence.upper()
    for frame in range(3):
        for i in range(frame, len(seq) - 2, 3):
            if seq[i:i+3] == "ATG":
                for j in range(i + 3, len(seq) - 2, 3):
                    if seq[j:j+3] in {"TAA", "TAG", "TGA"}:
                        orf_seq = seq[i:j+3]
                        if len(orf_seq) // 3 >= min_protein_len:
                            orfs.append((i, j+3, orf_seq))
                        break
    return orfs

2. Importing Modules in Scripts

Python provides several clean syntaxes to import modules and specific functions into your analysis workflows:

# Approach 1: Import entire module
import seq_tools
gc = seq_tools.calculate_gc("ATGCGCGCTAGC")

# Approach 2: Import specific functions
from seq_tools import calculate_gc, find_orfs
orfs = find_orfs("ATGGGATCGTAGCTAGCTAGCTAA")

# Approach 3: Import with namespace alias
import seq_tools as st
print("GC Content:", st.calculate_gc("CCCGGG"))
Standard Library Essentials for Biologists

Python comes bundled with robust built-in modules critical for bioinformaticians:

  • os & pathlib: Path manipulation, directory traversal, and automated file discovery.
  • gzip: Direct reading and writing of compressed .fastq.gz and .vcf.gz streams.
  • collections.Counter: Ultra-fast k-mer and base frequency counting.
  • itertools: Generating codon combinations, sliding windows, and pairwise sequence comparisons.

3. Using Modules Across Multiple Files & Packages

A package is a directory containing multiple modules and an __init__.py file. Here is the recommended directory structure for a production bioinformatics tool:

my_ngs_tool/
├── __init__.py           # Marks directory as Python package
├── config.py             # Pipeline parameters, paths, thresholds
├── parsers/
│   ├── __init__.py
│   ├── fasta.py          # FASTA & FASTQ reader/writer
│   └── vcf.py            # Variant Call Format processor
├── algorithms/
│   ├── __init__.py
│   ├── alignment.py      # Smith-Waterman / Needleman-Wunsch
│   └── filtering.py      # Depth, Quality & Allele Frequency filters
└── main.py               # Command-line entrypoint (argparse/click)
← Return to Home Hub Scroll to Top ↑