Defining functions
Functions
Functions in Python are an essential tool for organizing and reusing code. A function is a block of code that performs a specific task and can be called from other parts of a program. Functions are useful for biology students when working with large datasets or analyzing biological systems.
Here are some basic concepts of functions in Python:
Defining functions
A function is defined in Python using the def keyword, followed by the name of the function, and any parameters that it takes as inputs. The code that makes up the function is indented under the def statement. Here’s an example:
# Define a function that calculates the GC content of a DNA sequence
def calculate_gc(sequence):
gc_count = sequence.count('G') + sequence.count('C')
gc_content = gc_count / len(sequence)
return gc_content
In this example, we define a function called calculate_gc that takes a single input parameter, sequence. The code inside the function calculates the number of G’s and C’s in the sequence and divides by the total length of the sequence to calculate the GC content. The function returns the GC content as a value.
Calling a function
Once a function is defined, it can be called from other parts of the program. To call a function, use the name of the function, followed by any input parameters that the function requires. Here’s an example:
# Call the calculate_gc function with a DNA sequence as input
my_sequence = 'ACTCTGACGATCGATGCTACGAGCTAGCACGATCAGTC'
gc_content = calculate_gc(my_sequence)
print('GC content is:', gc_content)
print('% GC content is:', gc_content *100, '%')
In this example, we call the calculate_gc function and pass it a DNA sequence as input. The function calculates the GC content of the sequence and returns the value. We assign the returned value to the variable gc_content and then print the value to the console.
Scope
Functions in Python have their own scope, which means that any variables or other objects created inside the function are not accessible outside of the function. This can be useful for preventing naming conflicts between different parts of a program. Here’s an example:
# Define a function that modifies a list
def modify_list(my_list):
my_list.append(5)
return my_list
# Create a list and call the modify_list function
my_list = [1, 2, 3, 4]
modified_list = modify_list(my_list)
# The original list is not affected by the function call
print(my_list) # Output: [1, 2, 3, 4]
# The modified list is returned by the function
print(modified_list) # Output: [1, 2, 3, 4, 5]
In this example, we define a function called modify_list that appends the value 5 to a list and returns the modified list. We call the function with a list as input, and the function returns a modified list with the value 5 added. However, the original list is not affected by the function call because it is out of scope.
Functions are an essential tool for organizing and reusing code in Python. By defining functions that perform specific tasks, you can create modular code that can be easily maintained and reused in different parts of a program.